pTRE3G-mouse cGASdeltaN-GFP
(Plasmid
#186878)
-
PurposeDoxycycline-dependent expression of mouse cGAS gene in mammalian cells by retroviral transduction
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186878 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRetroX-TRE3G Vector
-
Backbone manufacturerTakara Bio
- Backbone size w/o insert (bp) 6600
-
Vector typeRetroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMouse cGAS truncation mutant (148-508 a.a.) with C-terminal GFP fusion
-
Alt nameHuman cGAS truncation mutant (160-522 a.a.) with N-terminal FLAG tag and C-terminal MAVS transmembrane domain fusion
-
Alt namecGASdeltaN
-
SpeciesM. musculus (mouse), Synthetic
-
Insert Size (bp)1788
-
MutationN-terminal truncation
-
Entrez GeneCgas (a.k.a. E330016A19Rik, Mb21d1)
- Promoter TRE3G
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer pCEP_Fw (agagctcgtttagtgaaccg)
- 3′ sequencing primer MSCV_Rv (cagcggggctgctaaagcgcatgc) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Contains Kozak sequence (gccacc) before start codon. Glycine-Serine linker is inserted between cGAS and GFP. Please visit https://www.biorxiv.org/content/10.1101/2022.03.09.483681v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRE3G-mouse cGASdeltaN-GFP was a gift from Jonathan Kagan (Addgene plasmid # 186878 ; http://n2t.net/addgene:186878 ; RRID:Addgene_186878) -
For your References section:
Species-specific self-DNA detection mechanisms by mammalian cyclic GMP-AMP synthases. Mosallanejad K, Kennedy SN, Bahleda KM, Slavik KM, Zhou W, Govande AA, Hancks DC, Kranzusch PJ, Kagan JC. Sci Immunol. 2023 Jan 20;8(79):eabp9765. doi: 10.1126/sciimmunol.abp9765. Epub 2023 Jan 20. 10.1126/sciimmunol.abp9765 PubMed 36662885