pTRE3G-WHG cGASdeltaN-HA
(Plasmid
#186868)
-
PurposeDoxycycline-dependent expression of white-handed gibbon cGAS gene in mammalian cells by retroviral transduction
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186868 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRetroX-TRE3G Vector
-
Backbone manufacturerTakara Bio
- Backbone size w/o insert (bp) 6600
-
Vector typeRetroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameWhite-handed gibbon cGAS truncation mutant (193-557 a.a.) with C-terminal HA tag
-
Alt namecGAS
-
Alt namecGASdeltaN
-
SpeciesSynthetic; Hylobates lar
-
Insert Size (bp)1134
-
MutationN-terminal truncation
- Promoter TRE3G
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer pCEP_Fw (agagctcgtttagtgaaccg)
- 3′ sequencing primer MSCV_Rv (cagcggggctgctaaagcgcatgc) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Contains Kozak sequence (gccacc) before start codon. Please visit https://www.biorxiv.org/content/10.1101/2022.03.09.483681v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRE3G-WHG cGASdeltaN-HA was a gift from Jonathan Kagan (Addgene plasmid # 186868 ; http://n2t.net/addgene:186868 ; RRID:Addgene_186868) -
For your References section:
Species-specific self-DNA detection mechanisms by mammalian cyclic GMP-AMP synthases. Mosallanejad K, Kennedy SN, Bahleda KM, Slavik KM, Zhou W, Govande AA, Hancks DC, Kranzusch PJ, Kagan JC. Sci Immunol. 2023 Jan 20;8(79):eabp9765. doi: 10.1126/sciimmunol.abp9765. Epub 2023 Jan 20. 10.1126/sciimmunol.abp9765 PubMed 36662885