pRS426 Gal-RNQ1-YFP
(Plasmid #18686)

• Depositing Lab: Susan Lindquist
• Publication: Douglas et al Proc Natl Acad Sci U S A. 2008 May 20. 105(20):7206-11.

Backbone

• Vector backbone: pRS426 Gal
• Backbone size w/o insert (bp): 7099
• Vector type: Yeast Expression
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Rnq1
• Alt name: Rnq1 YFP
• Alt name: Gal-Rnq1-YFP p426
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 1215
• Entrez Gene: RNQ1 (a.k.a. YCL028W)
• Tag / Fusion Protein:
  • YFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xba1 (not destroyed)
• 3′ cloning site: BamH1 (not destroyed)
• 5′ sequencing primer: From Gal Promoter GTTAATATACCTCTATACTTTAACGTCAAGGAGA

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry