Skip to main content
Addgene

pTRE3G-human cGAS:158-522aa-HA
(Plasmid #186857)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186857 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRetroX-TRE3G Vector
  • Backbone manufacturer
    Takara Bio
  • Backbone size w/o insert (bp) 6600
  • Vector type
    Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human cGAS truncation mutant (158-522 a.a.) with C-terminal HA tag
  • Alt name
    cGAS
  • Alt name
    cGASdeltaN
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1134
  • Mutation
    N-terminal truncation
  • Entrez Gene
    Adamts1 (a.k.a. ADAM-TS1, ADAMTS, ADAMTS-1, C3-C5, METH-1, METH1)
  • Promoter TRE3G
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer pCEP_Fw (agagctcgtttagtgaaccg)
  • 3′ sequencing primer MSCV_Rv (cagcggggctgctaaagcgcatgc)
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Contains Kozak sequence (gccacc) before start codon. Please visit https://www.biorxiv.org/content/10.1101/2022.03.09.483681v2 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRE3G-human cGAS:158-522aa-HA was a gift from Jonathan Kagan (Addgene plasmid # 186857 ; http://n2t.net/addgene:186857 ; RRID:Addgene_186857)
  • For your References section:

    Species-specific self-DNA detection mechanisms by mammalian cyclic GMP-AMP synthases. Mosallanejad K, Kennedy SN, Bahleda KM, Slavik KM, Zhou W, Govande AA, Hancks DC, Kranzusch PJ, Kagan JC. Sci Immunol. 2023 Jan 20;8(79):eabp9765. doi: 10.1126/sciimmunol.abp9765. Epub 2023 Jan 20. 10.1126/sciimmunol.abp9765 PubMed 36662885