pGL3-Camk2d
(Plasmid
#186820)
-
PurposeFluorescent reporter for Camk2d expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186820 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGL3-Basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4818
- Total vector size (bp) 5984
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCamk2d promoter
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1181
-
Entrez GeneCamk2d (a.k.a. 2810011D23Rik, 8030469K03Rik, CaMK II, [d]-CaMKII)
- Promoter Camk2d promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer CTTACGCGTCCACCACTTACACCTTAACCCA
- 3′ sequencing primer CGCAGATCTCACGGAGAGCTCAACGCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-Camk2d was a gift from Hung-Chun Chang (Addgene plasmid # 186820 ; http://n2t.net/addgene:186820 ; RRID:Addgene_186820) -
For your References section:
ISX-9 potentiates CaMKIIdelta-mediated BMAL1 activation to enhance circadian amplitude. Li H, Ou J, Li Y, Xu N, Li Q, Wu P, Peng C, Tang YC, Chang HC. Commun Biol. 2022 Jul 28;5(1):750. doi: 10.1038/s42003-022-03725-x. 10.1038/s42003-022-03725-x PubMed 35902736