Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSSa26
(Plasmid #186784)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186784 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pVS29
  • Total vector size (bp) 8248
  • Vector type
    Yeast Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CgrtTA
  • Insert Size (bp)
    1041
  • Promoter ScPGK1p

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer GTATTTCACACCGCATAGGGT
  • 3′ sequencing primer CCAACACCGTTCAACAACTCCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSSa26 was a gift from Dominique Sanglard (Addgene plasmid # 186784 ; http://n2t.net/addgene:186784 ; RRID:Addgene_186784)
  • For your References section:

    A novel Candida glabrata doxycycline-inducible system for in vitro/in vivo use. Schrevens S, Sanglard D. FEMS Yeast Res. 2022 Sep 24;22(1):foac046. doi: 10.1093/femsyr/foac046. 10.1093/femsyr/foac046 PubMed 36047937
Commonly requested with: