pGAPDH::H2B-mScarlet
(Plasmid
#186764)
-
PurposeA plasmid containing planarian H2B fused to a planarian codon-optimized mScarlet, driven by the planarian GAPDH promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186764 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDEST-R4-R3
-
Backbone manufacturerThermoFisher
- Backbone size w/o insert (bp) 6727
- Total vector size (bp) 7801
-
Vector typeOverexpression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH2B-mScarlet
-
SpeciesSchmidtea mediterranea
-
Insert Size (bp)1073
- Promoter GAPDH
-
Tag
/ Fusion Protein
- H2B
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CAGGAAACAGCTATGACCATG
- 3′ sequencing primer TGTAAAACGACGGCCAGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGAPDH::H2B-mScarlet was a gift from Bo Wang (Addgene plasmid # 186764 ; http://n2t.net/addgene:186764 ; RRID:Addgene_186764) -
For your References section:
Heterologous reporter expression in the planarian Schmidtea mediterranea through somatic mRNA transfection. Hall RN, Weill U, Drees L, Leal-Ortiz S, Li H, Khariton M, Chai C, Xue Y, Rosental B, Quake SR, Sanchez Alvarado A, Melosh NA, Fire AZ, Rink JC, Wang B. Cell Rep Methods. 2022 Sep 20;2(10):100298. doi: 10.1016/j.crmeth.2022.100298. eCollection 2022 Oct 24. 10.1016/j.crmeth.2022.100298 PubMed 36313809