peGFP-N1-Cofilin-S41E
(Plasmid
#186748)
-
PurposeExpresses S41E phosphomimetic GFP-tagged human cofilin in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186748 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-N1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCofilin-1
-
Alt namep18
-
Alt nameCFL1
-
SpeciesH. sapiens (human)
-
MutationChanged serine 41 to glutamic acid
-
GenBank IDNM_005507.2
-
Entrez GeneCFL1 (a.k.a. CFL, HEL-S-15, cofilin)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer TAACAACTCCGCCCCATT
- 3′ sequencing primer GTCCAGCTCGACCAGGATGGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySynthetic gene
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
peGFP-N1-Cofilin-S41E was a gift from Geert van den Bogaart (Addgene plasmid # 186748 ; http://n2t.net/addgene:186748 ; RRID:Addgene_186748) -
For your References section:
Atypical cofilin signaling drives dendritic cell migration through the extracellular matrix via nuclear deformation. Warner H, Franciosa G, van der Borg G, Coenen B, Faas F, Koenig C, de Boer R, Classens R, Maassen S, Baranov MV, Mahajan S, Dabral D, Bianchi F, van Hilten N, Risselada HJ, Roos WH, Olsen JV, Cano LQ, van den Bogaart G. Cell Rep. 2024 Feb 27;43(3):113866. doi: 10.1016/j.celrep.2024.113866. 10.1016/j.celrep.2024.113866 PubMed 38416638