Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMpGE_En03-sgRNA_Target1 (Mpphot)
(Plasmid #186726)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186726 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMpGE_En03
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA_Mphot
  • Alt name
    sgRNA_Target1
  • gRNA/shRNA sequence
    GCAGACGATGAATCCGTGGA

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMpGE_En03-sgRNA_Target1 (Mpphot) was a gift from Yutaka Kodama (Addgene plasmid # 186726 ; http://n2t.net/addgene:186726 ; RRID:Addgene_186726)
  • For your References section:

    SKLPT imaging: Efficient in vivo pre-evaluation of genome-editing modules using fluorescent protein with peroxisome targeting signal. Konno R, Tanaka H, Kodama Y. Biochem Biophys Res Commun. 2018 Sep 3;503(1):235-241. doi: 10.1016/j.bbrc.2018.06.008. Epub 2018 Jun 12. 10.1016/j.bbrc.2018.06.008 PubMed 29885839