Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCF806-shRen.713
(Plasmid #186712)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 186712 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCF806
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shRen.713
  • gRNA/shRNA sequence
    tagataagcattataattccta
  • Species
    Renilla luciferase

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCF806-shRen.713 was a gift from Christof Fellmann (Addgene plasmid # 186712 ; http://n2t.net/addgene:186712 ; RRID:Addgene_186712)
  • For your References section:

    Endogenous spacing enables co-processing of microRNAs and efficient combinatorial RNAi. Amen AM, Loughran RM, Huang CH, Lew RJ, Ravi A, Guan Y, Schatoff EM, Dow LE, Emerling BM, Fellmann C. Cell Rep Methods. 2022 Jun 21;2(7):100239. doi: 10.1016/j.crmeth.2022.100239. eCollection 2022 Jul 18. 10.1016/j.crmeth.2022.100239 PubMed 35880017