pSEVA251::Ptrc.x.tetO2::B0032::CYP110D1 N-terminal His-Tag
(Plasmid #186710)

• Purpose: N-terminal His-tagged CYP110D1 coding sequence under the control of Ptrc.x.tetO2 promoter and the BBa_B0032 RBS, for the expression in Synechocystis.
• Depositing Lab: Paula Tamagnini
• Publication: Mascia et al Green Chemistry, 24 (2022):6156

Backbone

• Vector backbone: pSEVA251
• Backbone size w/o insert (bp): 5303
• Total vector size (bp): 6777
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: alr4766
• Alt name: CYP110D1
• Species: Nostoc sp. PCC 7120
• Insert Size (bp): 1474
• Promoter: Ptrc.x.tetO2
• Tag / Fusion Protein:
  • His-Tag (6His) (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XmaI (not destroyed)
• 3′ cloning site: PstI (not destroyed)
• 5′ sequencing primer: gcggataacaatttcacacag
• 3′ sequencing primer: gaacaaatccagatggagttc

Resource Information

• Supplemental Documents:
  • pSEVA251_Ptrc.x.tetO2_B32_110D1 N-his.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry