SETD2(SET)-Cas9
(Plasmid
#186700)
-
PurposePlasmid encoding SETD2-Cas9 fusion under CMV promoter
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186700 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepCAGGS
- Backbone size w/o insert (bp) 4718
- Total vector size (bp) 10253
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSETD2(SET)-Cas9
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5535
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CTCTAGAGCCTCTGCTAACC
- 3′ sequencing primer GCCAGAAGTCAGATGCTCAAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SETD2(SET)-Cas9 was a gift from Jennifer Doudna (Addgene plasmid # 186700 ; http://n2t.net/addgene:186700 ; RRID:Addgene_186700) -
For your References section:
Decorating chromatin for enhanced genome editing using CRISPR-Cas9. Chen E, Lin-Shiao E, Trinidad M, Saffari Doost M, Colognori D, Doudna JA. Proc Natl Acad Sci U S A. 2022 Dec 6;119(49):e2204259119. doi: 10.1073/pnas.2204259119. Epub 2022 Dec 2. 10.1073/pnas.2204259119 PubMed 36459645
Map uploaded by the depositor.
