Skip to main content
Addgene

GLE_sgRNA
(Plasmid #186658)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186658 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pU6-BbsI-chiRNA
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Gle sgRNA Plasmid
  • gRNA/shRNA sequence
    GCGTATCCCCTTAACAATAA
  • Species
    D. melanogaster (fly)
  • Entrez Gene
    CG14749 (a.k.a. Dmel\CG14749)

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

sgRNA sequence: GCGTATCCCCTTAACAATAA. The corresponding genome sequence is: CCGTATCCCCTTAACAATAA.

Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GLE_sgRNA was a gift from Astrid Haase (Addgene plasmid # 186658 ; http://n2t.net/addgene:186658 ; RRID:Addgene_186658)
  • For your References section:

    Functional editing of endogenous genes through rapid selection of cell pools (Rapid generation of endogenously tagged genes in Drosophila ovarian somatic sheath cells). Meng Q, Stoyko D, Andrews CM, Konstantinidou P, Genzor P, O T, Elchert AR, Benner L, Sobti S, Katz EY, Haase AD. Nucleic Acids Res. 2022 May 27. pii: 6594084. doi: 10.1093/nar/gkac448. 10.1093/nar/gkac448 PubMed 35639929