pFIV-H1-Puro-hPolß
(Plasmid #18663)

• Depositing Lab: Robert Sobol
• Publication: Trivedi et al Molecular Pharmacology 2008;74(2):505-16.

Backbone

• Vector backbone: pFIV-H1-Puro
• Backbone manufacturer: System Biosciences
• Backbone size w/o insert (bp): 6261
• Vector type: Mammalian Expression, Lentiviral, RNAi
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: shRNA specific to human DNA polymerase beta
• Species: H. sapiens (human)
• Insert Size (bp): 65
• Mutation: none
• GenBank ID: NM_002690
• Entrez Gene: POLB

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TGTCTTTGGATTTGGGAATCTTAT
• 3′ sequencing primer: ATTTATTGTATCTGTGGGAGCCTC

Resource Information

• Supplemental Documents:
  • pol beta knockdown figure
• A portion of this plasmid was derived from a plasmid made by: Derived from a vector system of System Biosciences.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please see attachment for knockdown figure from published article.