pFIV-H1-Puro-hPolß
(Plasmid
#18663)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 18663 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFIV-H1-Puro
-
Backbone manufacturerSystem Biosciences
- Backbone size w/o insert (bp) 6261
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshRNA specific to human DNA polymerase beta
-
SpeciesH. sapiens (human)
-
Insert Size (bp)65
-
Mutationnone
-
GenBank IDNM_002690
-
Entrez GenePOLB
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TGTCTTTGGATTTGGGAATCTTAT
- 3′ sequencing primer ATTTATTGTATCTGTGGGAGCCTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDerived from a vector system of System Biosciences.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please see attachment for knockdown figure from published article.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFIV-H1-Puro-hPolß was a gift from Robert Sobol (Addgene plasmid # 18663 ; http://n2t.net/addgene:18663 ; RRID:Addgene_18663) -
For your References section:
Human methyl purine DNA glycosylase and DNA polymerase {beta} expression collectively predict sensitivity to temozolomide. Trivedi RN, Wang XH, Jelezcova E, Goellner EM, Tang J, Sobol RW. Molecular Pharmacology 2008;74(2):505-16. 10.1124/mol.108.045112 PubMed 18477668