Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pFIV-H1-Puro-hPolß
(Plasmid #18663)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 18663 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFIV-H1-Puro
  • Backbone manufacturer
    System Biosciences
  • Backbone size w/o insert (bp) 6261
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shRNA specific to human DNA polymerase beta
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    65
  • Mutation
    none
  • GenBank ID
    NM_002690
  • Entrez Gene
    POLB

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TGTCTTTGGATTTGGGAATCTTAT
  • 3′ sequencing primer ATTTATTGTATCTGTGGGAGCCTC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Derived from a vector system of System Biosciences.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please see attachment for knockdown figure from published article.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFIV-H1-Puro-hPolß was a gift from Robert Sobol (Addgene plasmid # 18663 ; http://n2t.net/addgene:18663 ; RRID:Addgene_18663)
  • For your References section:

    Human methyl purine DNA glycosylase and DNA polymerase {beta} expression collectively predict sensitivity to temozolomide. Trivedi RN, Wang XH, Jelezcova E, Goellner EM, Tang J, Sobol RW. Molecular Pharmacology 2008;74(2):505-16. 10.1124/mol.108.045112 PubMed 18477668