pTE1069
(Plasmid
#186629)
-
PurposeSCB-GFP E. coli reporter plasmid. Encodes repressor ScbR and ScbAp promoter upstream of GFP.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186629 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneBC-A1-002 (Addgene #78689)
- Backbone size w/o insert (bp) 2200
- Total vector size (bp) 3987
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namescbR
-
Alt nameSCO6265
-
SpeciesStreptomyces coelicolor
-
Insert Size (bp)645
- Promoter BBa_J23100
-
Tag
/ Fusion Protein
- 6xArg (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GTTGACGGCTAGCTCAGTC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namescbAp promoter
-
SpeciesStreptomyces coelicolor
-
Insert Size (bp)35
- Promoter scbAp
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer TTGTGTCCAAGAATGTTTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTE1069 was a gift from Eriko Takano (Addgene plasmid # 186629 ; http://n2t.net/addgene:186629 ; RRID:Addgene_186629) -
For your References section:
Orthogonal Regulatory Circuits for Escherichia coli Based on the gamma-Butyrolactone System of Streptomyces coelicolor. Biarnes-Carrera M, Lee CK, Nihira T, Breitling R, Takano E. ACS Synth Biol. 2018 Apr 20;7(4):1043-1055. doi: 10.1021/acssynbio.7b00425. Epub 2018 Mar 19. 10.1021/acssynbio.7b00425 PubMed 29510026