pMR506-EF1a-H2B-EGFP
(Plasmid
#186627)
-
PurposeExpresses nuclear-localised EGFP under EF1a promoter. For insertion of genetic barcodes into 3'UTR of EGFP.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186627 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneLV-GFP
-
Backbone manufacturerAddgene (Plasmid #25999)
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEF1a
-
SpeciesSynthetic
-
Insert Size (bp)1179
-
Entrez GeneEEF1A1 (a.k.a. CCS-3, CCS3, EE1A1, EEF-1, EEF1A, EF-Tu, EF1A, EF1A1, EF1alpha1, GRAF-1EF, LENG7, PTI1, eEF1A-1)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT
- 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMR506-EF1a-H2B-EGFP was a gift from Jonas Frisén (Addgene plasmid # 186627 ; http://n2t.net/addgene:186627 ; RRID:Addgene_186627) -
For your References section:
Clonal relations in the mouse brain revealed by single-cell and spatial transcriptomics. Ratz M, von Berlin L, Larsson L, Martin M, Westholm JO, La Manno G, Lundeberg J, Frisen J. Nat Neurosci. 2022 Mar;25(3):285-294. doi: 10.1038/s41593-022-01011-x. Epub 2022 Feb 24. 10.1038/s41593-022-01011-x PubMed 35210624