Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMR506-EF1a-H2B-EGFP
(Plasmid #186627)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186627 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    LV-GFP
  • Backbone manufacturer
    Addgene (Plasmid #25999)
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EF1a
  • Species
    Synthetic
  • Insert Size (bp)
    1179
  • Entrez Gene
    EEF1A1 (a.k.a. CCS-3, CCS3, EE1A1, EEF-1, EEF1A, EF-Tu, EF1A, EF1A1, EF1alpha1, GRAF-1EF, LENG7, PTI1, eEF1A-1)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMR506-EF1a-H2B-EGFP was a gift from Jonas Frisén (Addgene plasmid # 186627 ; http://n2t.net/addgene:186627 ; RRID:Addgene_186627)
  • For your References section:

    Clonal relations in the mouse brain revealed by single-cell and spatial transcriptomics. Ratz M, von Berlin L, Larsson L, Martin M, Westholm JO, La Manno G, Lundeberg J, Frisen J. Nat Neurosci. 2022 Mar;25(3):285-294. doi: 10.1038/s41593-022-01011-x. Epub 2022 Feb 24. 10.1038/s41593-022-01011-x PubMed 35210624