pMCSG53-DsbC
(Plasmid #186623)

• Purpose: (Empty Backbone) E. coli expression vector containing N-terminal leaderless DsbC-6His-TEV fusion.
• Depositing Lab: Alexei Savchenko
• Publication: Venkatesan et al iScience. 2022 Sep 3;25(10):105054. doi: 10.1016/j.isci.2022.105054. eCollection 2022 Oct 21.

Backbone

• Vector backbone: pMCSG53
• Backbone manufacturer: Eschenfeldt, W. H., Makowska-Grzyska, M., Stols, L., Donnelly, M. I., Jedrzejczak, R., & Joachimiak, A.
• Backbone size (bp): 5834
• Modifications to backbone: A leaderless DsbC protein has been added in-frame upstream of a 6His-TEV site. Facilitates cytosolic expression of disulfide-rich proteins in E.coli including many families of growth factors.
• Vector type: Bacterial Expression
• Promoter: T7
• Tag / Fusion Protein:
  • DsbC-6His-TEV (N terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: High Copy

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Read the preprint on bioRxiv: https://www.biorxiv.org/content/10.1101/2022.02.15.480596v1.