YFP-Stim1-D76A
(Plasmid #186622)

• Purpose: Encodes Stim1 mutant D76A fused to YFP
• Depositing Lab: Gia Voeltz
• Publication: Zamponi et al Dev Cell. 2022 Jun 6;57(11):1369-1382.e6. doi: 10.1016/j.devcel.2022.05.002. Epub 2022 May 23.

Backbone

• Vector backbone: pEX-SP-YFP-STIM1(23-685) (Plasmid #18857)
• Total vector size (bp): 6859
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Stromal Interaction Molecule 1
• Alt name: Stim1
• Species: H. sapiens (human)
• Insert Size (bp): 2055
• Mutation: D76A
• GenBank ID: NM_003156
• Entrez Gene: STIM1 (a.k.a. D11S4896E, GOK, IMD10, STRMK, TAM, TAM1)
• Promoter: CMV
• Tag / Fusion Protein:
  • YFP (N terminal on backbone)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: aggtcttccctcaggaactcatca
• 3′ sequencing primer: caagcccctgtgtcacagt

Resource Information

• Supplemental Documents:
  • YFP-Stim1-D76A.gbk
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry