pLV-Kif5c-Myc
(Plasmid #186616)

• Purpose: Third generation lentiviral vector expressing Kinesin Heavy Chain 5 isoform C fused to Myc tag
• Depositing Lab: Gia Voeltz
• Publication: Zamponi et al Dev Cell. 2022 Jun 6;57(11):1369-1382.e6. doi: 10.1016/j.devcel.2022.05.002. Epub 2022 May 23.

Backbone

• Vector backbone: pLV-eGFP_Addgene#36083
• Total vector size (bp): 9603
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Kinesin Heavy Chain isoform 5c
• Alt name: Kif5c
• Species: H. sapiens (human)
• Insert Size (bp): 2871
• GenBank ID: NM_004522.3
• Entrez Gene: KIF5C (a.k.a. CDCBM2, KINN, NKHC, NKHC-2, NKHC2)
• Promoter: CMV
• Tag / Fusion Protein:
  • Myc tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: gcagagctcgtttagtgaaccg
• 3′ sequencing primer: gcattaaagcagcgtatccacat

Resource Information

• Supplemental Documents:
  • pLV-Kif5c-Myc.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry