pMMB67EH-dddAI-FLAG
(Plasmid
#186560)
-
PurposeBroad host range regulated expression of the DddA immunity determinant with a C-terminal fusion to a FLAG epitope (DddAI-FLAG)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186560 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMMB67EH
- Backbone size w/o insert (bp) 8829
- Total vector size (bp) 9222
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedddAI
-
Alt namedddI
-
SpeciesBurkholderia cenocepacia
-
Insert Size (bp)396
- Promoter tac
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGGTTCTGGCAAATATTCTG
- 3′ sequencing primer TTCGGCATGGGGTCAGGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMMB67EH-dddAI-FLAG was a gift from Joseph Mougous (Addgene plasmid # 186560 ; http://n2t.net/addgene:186560 ; RRID:Addgene_186560) -
For your References section:
Genome-wide protein-DNA interaction site mapping in bacteria using a double-stranded DNA-specific cytosine deaminase. Gallagher LA, Velazquez E, Peterson SB, Charity JC, Radey MC, Gebhardt MJ, Hsu F, Shull LM, Cutler KJ, Macareno K, de Moraes MH, Penewit KM, Kim J, Andrade PA, LaFramboise T, Salipante SJ, Reniere ML, de Lorenzo V, Wiggins PA, Dove SL, Mougous JD. Nat Microbiol. 2022 Jun;7(6):844-855. doi: 10.1038/s41564-022-01133-9. Epub 2022 Jun 1. 10.1038/s41564-022-01133-9 PubMed 35650286