Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMMB67EH-dddAI-FLAG
(Plasmid #186560)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186560 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMMB67EH
  • Backbone size w/o insert (bp) 8829
  • Total vector size (bp) 9222
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dddAI
  • Alt name
    dddI
  • Species
    Burkholderia cenocepacia
  • Insert Size (bp)
    396
  • Promoter tac
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGGTTCTGGCAAATATTCTG
  • 3′ sequencing primer TTCGGCATGGGGTCAGGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMMB67EH-dddAI-FLAG was a gift from Joseph Mougous (Addgene plasmid # 186560 ; http://n2t.net/addgene:186560 ; RRID:Addgene_186560)
  • For your References section:

    Genome-wide protein-DNA interaction site mapping in bacteria using a double-stranded DNA-specific cytosine deaminase. Gallagher LA, Velazquez E, Peterson SB, Charity JC, Radey MC, Gebhardt MJ, Hsu F, Shull LM, Cutler KJ, Macareno K, de Moraes MH, Penewit KM, Kim J, Andrade PA, LaFramboise T, Salipante SJ, Reniere ML, de Lorenzo V, Wiggins PA, Dove SL, Mougous JD. Nat Microbiol. 2022 Jun;7(6):844-855. doi: 10.1038/s41564-022-01133-9. Epub 2022 Jun 1. 10.1038/s41564-022-01133-9 PubMed 35650286