Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDYT001
(Plasmid #186549)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 186549 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBA439
  • Backbone size w/o insert (bp) 9152
  • Total vector size (bp) 9152
  • Vector type
    Mammalian Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    14-bp random integration barcode and three target sites and 3x sgRNAs
  • Alt name
    lineage tracing target sites and corresponding sgRNAs
  • Species
    Synthetic
  • Insert Size (bp)
    291
  • Promoter EF1alpha

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTCACCATAACTGTAAAATT (for checking sgRNAs)
  • 3′ sequencing primer ggcatggacgagctgtacaag (for checking Target Sites)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDYT001 was a gift from Jonathan Weissman (Addgene plasmid # 186549 ; http://n2t.net/addgene:186549 ; RRID:Addgene_186549)
  • For your References section:

    Lineage tracing reveals the phylodynamics, plasticity, and paths of tumor evolution. Yang D, Jones MG, Naranjo S, Rideout WM 3rd, Min KHJ, Ho R, Wu W, Replogle JM, Page JL, Quinn JJ, Horns F, Qiu X, Chen MZ, Freed-Pastor WA, McGinnis CS, Patterson DM, Gartner ZJ, Chow ED, Bivona TG, Chan MM, Yosef N, Jacks T, Weissman JS. Cell. 2022 Apr 28. pii: S0092-8674(22)00462-7. doi: 10.1016/j.cell.2022.04.015. 10.1016/j.cell.2022.04.015 PubMed 35523183