pDYT001
(Plasmid
#186549)
-
PurposeLineage tracing vector (with barcoded Target Sites and triple sgRNAs)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186549 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBA439
- Backbone size w/o insert (bp) 9152
- Total vector size (bp) 9152
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name14-bp random integration barcode and three target sites and 3x sgRNAs
-
Alt namelineage tracing target sites and corresponding sgRNAs
-
SpeciesSynthetic
-
Insert Size (bp)291
- Promoter EF1alpha
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTCACCATAACTGTAAAATT (for checking sgRNAs)
- 3′ sequencing primer ggcatggacgagctgtacaag (for checking Target Sites) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDYT001 was a gift from Jonathan Weissman (Addgene plasmid # 186549 ; http://n2t.net/addgene:186549 ; RRID:Addgene_186549) -
For your References section:
Lineage tracing reveals the phylodynamics, plasticity, and paths of tumor evolution. Yang D, Jones MG, Naranjo S, Rideout WM 3rd, Min KHJ, Ho R, Wu W, Replogle JM, Page JL, Quinn JJ, Horns F, Qiu X, Chen MZ, Freed-Pastor WA, McGinnis CS, Patterson DM, Gartner ZJ, Chow ED, Bivona TG, Chan MM, Yosef N, Jacks T, Weissman JS. Cell. 2022 Apr 28. pii: S0092-8674(22)00462-7. doi: 10.1016/j.cell.2022.04.015. 10.1016/j.cell.2022.04.015 PubMed 35523183