pBAD-FOLD6
(Plasmid
#186547)
-
PurposeFOLD6 "hyperfolder" green fluorescent protein: bacterial expression plasmid
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186547 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBAD/His-B
-
Backbone manufacturerInvitrogen
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFOLD6
-
SpeciesSynthetic
-
Insert Size (bp)720
-
MutationmGreenLantern-C48S/V68L/C70V/K101E/T105Y/S147P/K149N/K206V/K221L/R223F/D234N
- Promoter araB
-
Tag
/ Fusion Protein
- 6xHis (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer pBAD-F (ATGCCATAGCATTTTTATCCA)
- 3′ sequencing primer pBAD-R (GATTTAATCTGTATCAGG) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Backbone is identical to that of Addgene #37129 (several amino acids between the FP insert and His-tag are removed).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD-FOLD6 was a gift from Gregory Petsko (Addgene plasmid # 186547 ; http://n2t.net/addgene:186547 ; RRID:Addgene_186547) -
For your References section:
Chemically stable fluorescent proteins for advanced microscopy. Campbell BC, Paez-Segala MG, Looger LL, Petsko GA, Liu CF. Nat Methods. 2022 Nov 7. pii: 10.1038/s41592-022-01660-7. doi: 10.1038/s41592-022-01660-7. 10.1038/s41592-022-01660-7 PubMed 36344833