pCytERM-LSSmGFP
(Plasmid #186540)

• Purpose: Visualization of the ER in cells using LSSmGFP (ex/em = 400/510 nm); compatible with OSER assay.
• Depositing Lab: Gregory Petsko
• Publication: Campbell et al Nat Methods. 2022 Nov 7. pii: 10.1038/s41592-022-01660-7. doi: 10.1038/s41592-022-01660-7.

Backbone

• Vector backbone: n/a
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LSSmGFP
• Species: Synthetic
• Insert Size (bp): 720
• Mutation: hfYFP-T43S/G65S/L68Q/H77N/K140N/Y203I/V206K
• Promoter: CMV
• Tag / Fusion Protein:
  • Cytochrome p450 first 29 animo acids (Oryctolagus cuniculus) (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BshTI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CMV Forward (CGCAAATGGGCGGTAGGCGTG)
• 3′ sequencing primer: SV40pA-R (GAAATTTGTGATGCTATTGC)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

400 nm excitation, 510 nm emission.