ER2-LSSmGFP
(Plasmid #186538)

• Purpose: Localization and retention of LSSmGFP fluorescent protein (ex/em = 400/510 nm) in the ER; improved targeting efficiency
• Depositing Lab: Gregory Petsko
• Publication: Campbell et al Nat Methods. 2022 Nov 7. pii: 10.1038/s41592-022-01660-7. doi: 10.1038/s41592-022-01660-7.

Backbone

• Vector backbone: pcDNA3.1
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LSSmGFP
• Species: Synthetic
• Insert Size (bp): 717
• Mutation: hfYFP-T43S/G65S/L68Q/H77N/K140N/Y203I/V206K
• Promoter: CMV
• Tags / Fusion Proteins:
  • Calreticulin (N terminal on insert)
  • KDEL (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CMV Forward (CGCAAATGGGCGGTAGGCGTG)
• 3′ sequencing primer: BGH Reverse (TAGAAGGCACAGTCGAGG)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

400 nm excitation, 510 nm emission. To improve ER localization, the Kozak sequence and ATG that were N-terminal to the FP have been deleted.