pET28-acatenin.22-906
(Plasmid
#186460)
-
PurposeExpresses human alpha-catenin (residues 22-906) with an N-terminal His tag and a PRescission Protease cleavage site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186460 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28
- Backbone size w/o insert (bp) 5314
- Total vector size (bp) 7972
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCTNNA1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2658
-
Entrez GeneCTNNA1 (a.k.a. CAP102, MDBS2, MDPT2)
-
Tag
/ Fusion Protein
- His (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer ATTGCCAGCATTCCTCAACT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28-acatenin.22-906 was a gift from Tina Izard (Addgene plasmid # 186460 ; http://n2t.net/addgene:186460 ; RRID:Addgene_186460) -
For your References section:
Distinct inter-domain interactions of dimeric versus monomeric alpha-catenin link cell junctions to filaments. Rangarajan ES, Smith EW, Izard T. Commun Biol. 2023 Mar 16;6(1):276. doi: 10.1038/s42003-023-04610-x. 10.1038/s42003-023-04610-x PubMed 36928388