Skip to main content

lentiCRISPR v2 sgKEAP1-2
(Plasmid #186459)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186459 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Backbone manufacturer
    Feng Zhang
  • Backbone size w/o insert (bp) 12000
  • Total vector size (bp) 12000
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Keap1 (Kelch-like ECH-associated protein 1)
  • gRNA/shRNA sequence
    CACCGTGTGTCCTCCACGTCATGAA
  • Species
    H. sapiens (human)
  • Entrez Gene
    KEAP1 (a.k.a. INrf2, KLHL19)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCRISPR v2 sgKEAP1-2 was a gift from Boyi Gan (Addgene plasmid # 186459 ; http://n2t.net/addgene:186459 ; RRID:Addgene_186459)
  • For your References section:

    A targetable CoQ-FSP1 axis drives ferroptosis- and radiation-resistance in KEAP1 inactive lung cancers. Koppula P, Lei G, Zhang Y, Yan Y, Mao C, Kondiparthi L, Shi J, Liu X, Horbath A, Das M, Li W, Poyurovsky MV, Olszewski K, Gan B. Nat Commun. 2022 Apr 22;13(1):2206. doi: 10.1038/s41467-022-29905-1. 10.1038/s41467-022-29905-1 PubMed 35459868