Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCas12b
(Plasmid #186449)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186449 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pACYC-duet
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Cas12b
  • Alt name
    C2c1
  • Alt name
    AacCas12b
  • Species
    A. acidoterrestris
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TGCGACTCCTGCATTAGGAAAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCas12b was a gift from John van der Oost (Addgene plasmid # 186449 ; http://n2t.net/addgene:186449 ; RRID:Addgene_186449)
  • For your References section:

    Adaptation by Type V-A and V-B CRISPR-Cas Systems Demonstrates Conserved Protospacer Selection Mechanisms Between Diverse CRISPR-Cas Types. Wu WY, Jackson SA, Almendros C, Haagsma AC, Yilmaz S, Gort G, van der Oost J, Brouns SJJ, Staals RHJ. CRISPR J. 2022 Aug;5(4):536-547. doi: 10.1089/crispr.2021.0150. Epub 2022 Jul 12. 10.1089/crispr.2021.0150 PubMed 35833800