pCas-mut4/1_2_VB
(Plasmid
#186444)
-
PurposeEncodes Cas4(K81A)/1, Cas2, leader, repeat and one spacer from A. acidoterrestris (type V-B)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186444 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepY002
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCas4/1 and Cas2
-
SpeciesA. acidoterrestris
-
MutationCas4 domain (K81A)
- Promoter T7
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer taatacgactcactataggg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCas-mut4/1_2_VB was a gift from John van der Oost (Addgene plasmid # 186444 ; http://n2t.net/addgene:186444 ; RRID:Addgene_186444) -
For your References section:
Adaptation by Type V-A and V-B CRISPR-Cas Systems Demonstrates Conserved Protospacer Selection Mechanisms Between Diverse CRISPR-Cas Types. Wu WY, Jackson SA, Almendros C, Haagsma AC, Yilmaz S, Gort G, van der Oost J, Brouns SJJ, Staals RHJ. CRISPR J. 2022 Aug;5(4):536-547. doi: 10.1089/crispr.2021.0150. Epub 2022 Jul 12. 10.1089/crispr.2021.0150 PubMed 35833800