pGEX-6P-HMP1_FABD
(Plasmid #186436)

• Purpose: Expresses the HMP1 F-actin Binding domain (677-927) with an N-terminal GST tag and a PRescission Protease cleavage site
• Depositing Lab: Tina Izard
• Publication: Rangarajan et al J Biol Chem. 2023 Feb;299(2):102817. doi: 10.1016/j.jbc.2022.102817. Epub 2022 Dec 17.

Backbone

• Vector backbone: pGEX-6P-1
• Backbone size w/o insert (bp): 4970
• Total vector size (bp): 5723
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HMP1 (F-actin Binding Domain)
• Species: C. elegans (nematode)
• Insert Size (bp): 753
• Entrez Gene: hmp-1 (a.k.a. CELE_R13H4.4)
• Tag / Fusion Protein:
  • GST (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: AvaI, BsoBI, PaeR7I, PspXI, XhoI, BmeT110I (unknown if destroyed)
• 5′ sequencing primer: GAGACATTGCAGAGTCAAGTGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: C.elegans cDNA clones were provided by: Yuji Kohara, Professor Center for Genetic Resource Informaiton National Institute of Genetics Research Organization of Information and Systems Mishima 411-8540, Japan Fax: +81-55-981-6855 E-mail:

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry