Skip to main content
Addgene

pBXNPHM3-Nb_MsbA#1
(Plasmid #186428)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186428 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pBXNPHM3
  • Backbone size w/o insert (bp) 5311
  • Total vector size (bp) 5662
  • Vector type
    Affinity Reagent/ Antibody

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Nanobody Nb_MsbA#1
  • Species
    Vicugna pacos
  • Insert Size (bp)
    351
  • Promoter pBAD
  • Tags / Fusion Proteins
    • PelB leader sequence (N terminal on backbone)
    • His Tag (N terminal on backbone)
    • Maltose Binding Protein (N terminal on backbone)
    • 3C cleavage site (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BspQI (not destroyed)
  • 3′ cloning site BspQI (not destroyed)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBXNPHM3-Nb_MsbA#1 was a gift from Markus Seeger (Addgene plasmid # 186428 ; http://n2t.net/addgene:186428 ; RRID:Addgene_186428)

  • For your References section:

    The ABC transporter MsbA adopts the wide inward-open conformation in E. coli cells. Galazzo L, Meier G, Januliene D, Parey K, De Vecchis D, Striednig B, Hilbi H, Schafer LV, Kuprov I, Moeller A, Bordignon E, Seeger MA. Sci Adv. 2022 Oct 14;8(41):eabn6845. doi: 10.1126/sciadv.abn6845. Epub 2022 Oct 12. 10.1126/sciadv.abn6845 PubMed 36223470
Related items:
Commonly requested with: