Skip to main content
Addgene

pDGB3omega1_KanR_BastaR
(Plasmid #186426)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186426 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pDGB3_omega1 (Plasmid #68238)
  • Backbone manufacturer
    GoldenBraid 2.0 kit from Diego Orzaez (Addgene kit # 1000000076 ), IBMCP, Valencia, Spain
  • Backbone size w/o insert (bp) 6702
  • Total vector size (bp) 10121
  • Vector type
    Plant Expression, Synthetic Biology ; binary vector for Escherichia coli and Agrobacterium tumefaciens-mediated plant transformation

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    KanR
  • Alt name
    kanamycin resistance
  • Alt name
    neomycin phosphotransferase II with nopaline synthase promoter/terminator
  • Alt name
    nptII
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)
    1398
  • Mutation
    BsaI and BsmBI sites removed
  • Promoter Pnos

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer pDGB3_omega_F: GGTGGCAGGATATATTGTGG
  • 3′ sequencing primer pDGB3_omega_R: CTTAGGTTTACCCGCCAATA
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    BastaR
  • Alt name
    bar gene for plant expression
  • Alt name
    phosphinothricin (bialaphos) resistance
  • Alt name
    phosphinothricin N-acetyltransferase
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)
    2021
  • Mutation
    BsaI and BsmBI sites removed
  • Promoter CaMV 35S

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer pDGB3_omega_F: GGTGGCAGGATATATTGTGG
  • 3′ sequencing primer pDGB3_omega_R: CTTAGGTTTACCCGCCAATA
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    we combined pEGB Tnos:NptII:Pnos (#68212, Addgene) and pDGB1alpha2_BastaR, which was prepared by Tomáš Moravec, IEB, Prague, Czech Republic

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDGB3omega1_KanR_BastaR was a gift from Lukas Fischer (Addgene plasmid # 186426 ; http://n2t.net/addgene:186426 ; RRID:Addgene_186426)

  • For your References section:

    Sulfadiazine and phosphinothricin selection systems optimised for the transformation of tobacco BY-2 cells. Kobercova E, Srba M, Fischer L. Plant Cell Rep. 2023 Jan 7. doi: 10.1007/s00299-022-02975-7. 10.1007/s00299-022-02975-7 PubMed 36609768
Related items:
Commonly requested with: