pDGB1alpha2_SulR
(Plasmid
#186425)
-
Purposetranscriptional unit for sulfadiazine resistance; plant expression driven by the Pnos promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186425 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDGB1_alpha2 (Plasmid #68225)
-
Backbone manufacturerGoldenBraid 2.0 kit from Diego Orzaez (Addgene kit # 1000000076 ), IBMCP, Valencia, Spain
- Backbone size w/o insert (bp) 2605
- Total vector size (bp) 4404
-
Vector typePlant Expression, Synthetic Biology ; binary vector for Escherichia coli and Agrobacterium tumefaciens-mediated plant transformation
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSulR
-
Alt namesulfadiazine resistance with nopaline synthase promoter/terminator
-
Alt namePnos:sulI:Tnos
-
SpeciesA. thaliana (mustard weed), Synthetic
-
Insert Size (bp)1799
-
MutationBsaI and BsmBI sites removed
- Promoter Pnos
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer pDGB1_alpha_F: CAACCTCTCGGGCTTCTGGA
- 3′ sequencing primer pDGB1_alpha_R: GCGACTTAGTTTACCCGCCAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDGB1alpha2_SulR was a gift from Lukas Fischer (Addgene plasmid # 186425 ; http://n2t.net/addgene:186425 ; RRID:Addgene_186425) -
For your References section:
Sulfadiazine and phosphinothricin selection systems optimised for the transformation of tobacco BY-2 cells. Kobercova E, Srba M, Fischer L. Plant Cell Rep. 2023 Jan 7. doi: 10.1007/s00299-022-02975-7. 10.1007/s00299-022-02975-7 PubMed 36609768