pAAV-Ef1a-DIO-Egr3-EYFP-WPRE
(Plasmid #186417)

• Purpose: Overexpression of Egr3 transcript variant 1 CDS under EF-1α promoter
• Depositing Lab: Mary Kay Lobo
• Publication: Chandra et al J Neurosci. 2015 May 20;35(20):7927-37. doi: 10.1523/JNEUROSCI.0548-15.2015.

Backbone

• Vector backbone: pAAV-Ef1a-DIO EYFP
• Backbone manufacturer: Karl Deisseroth
• Backbone size w/o insert (bp): 6313
• Total vector size (bp): 7487
• Modifications to backbone: Egr3 transcript variant CDS was inserted using restriction cloning by NcoI and NheI
• Vector type: AAV
• Selectable markers: Not Applicable

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Early growth response 3
• Alt name: Egr3
• Species: M. musculus (mouse)
• Insert Size (bp): 1161
• GenBank ID: 13655
• Entrez Gene: Egr3 (a.k.a. Pilot)
• Promoter: EF-1-alpha
• Tag / Fusion Protein:
  • EYFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: NheI (destroyed during cloning)
• 5′ sequencing primer: gctgaacttgtggccgttta
• 3′ sequencing primer: tgaaagccatacgggaagca

Resource Information

• Supplemental Documents:
  • pAAV-Ef1a-DIO-Egr3-EYFP-WPRE.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry