pDEST-pSP172BSSPE-R3-ccdB/CmR-R4-bpFOG-B5::B1-NLSLacZ-B2
(Plasmid
#186414)
-
PurposeAttR3/R4 destination vector for ascidian electroporation with AttB1/B2 recombined NLSLacZ under control of AttB4/B5-recombined pFOG ectodermal regulatory sequence.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186414 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDEST-pSP172BSSPE-R3-ccdB/CmR-R5::B1-NLSLacZ-B2
-
Backbone manufacturerPMID: 17878951
- Backbone size w/o insert (bp) 8537
-
Vector typeGateway destination vector
-
Selectable markersccdB gene
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namelacZ
-
SpeciesE. coli
-
Entrez GenelacZ (a.k.a. b0344, ECK0341)
- Promoter Basal promoter of the FOG gene
-
Tag
/ Fusion Protein
- Nuclear localization signal (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer Fw_pSP172BSSPE: ACAGCTTGTCTGTAAGCGGATGC
- 3′ sequencing primer Rv_pSP172BSSPE: TTGACACCAGACCAACTGGTAATG, SK primer (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Gateway destination vector for electroporation experiments.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDEST-pSP172BSSPE-R3-ccdB/CmR-R4-bpFOG-B5::B1-NLSLacZ-B2 was a gift from Patrick Lemaire (Addgene plasmid # 186414 ; http://n2t.net/addgene:186414 ; RRID:Addgene_186414) -
For your References section:
A multicassette Gateway vector set for high throughput and comparative analyses in ciona and vertebrate embryos. Roure A, Rothbacher U, Robin F, Kalmar E, Ferone G, Lamy C, Missero C, Mueller F, Lemaire P. PLoS One. 2007. 2(9):e916. 10.1371/journal.pone.0000916 PubMed 17878951