Skip to main content
Addgene

pDEST-pSP172BSSPE-Swa1::RfA
(Plasmid #186396)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186396 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Ascidian electroporation vector pSP72-1.27
  • Backbone manufacturer
    PMID: 9043074
  • Backbone size (bp) 4650
  • Vector type
    Gateway destination vector
  • Selectable markers
    ccdB gene

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    None

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Gateway destination vector for electroporation experiments. The electroporation vector pSP72-1.27 was modified to give rise to pSP72BSSPE by replacing the NLS-LacZ reporter gene, cloned between BamH1 and EcoR1 by a BamH1-Swa1-Stu1-Pme1-EcoRV-EcoR1 polylinker (GGATCCATTTAAATAGGCCTTTGTTTAAACTTAGATATCGGAATTC).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDEST-pSP172BSSPE-Swa1::RfA was a gift from Patrick Lemaire (Addgene plasmid # 186396 ; http://n2t.net/addgene:186396 ; RRID:Addgene_186396)

  • For your References section:

    A multicassette Gateway vector set for high throughput and comparative analyses in ciona and vertebrate embryos. Roure A, Rothbacher U, Robin F, Kalmar E, Ferone G, Lamy C, Missero C, Mueller F, Lemaire P. PLoS One. 2007. 2(9):e916. 10.1371/journal.pone.0000916 PubMed 17878951
Related items: