Skip to main content
Addgene

pDEST-Spe3-RfA
(Plasmid #186370)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186370 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    injection vector pRN3
  • Backbone manufacturer
    PMID: 7720076
  • Backbone size (bp) 4885
  • Vector type
    Gateway destination vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    None

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. The injection vector pRN3 was modified to give rise to pSPE3 by inserting a new polylinker EcoR1-Stu1-Pme1-EcoRV-Not1 (GAATTCAGGCCTTTGTTTAAACTTAGATATCGCGGCCGC) between the EcoR1 and Not1 sites.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDEST-Spe3-RfA was a gift from Patrick Lemaire (Addgene plasmid # 186370 ; http://n2t.net/addgene:186370 ; RRID:Addgene_186370)
  • For your References section:

    A multicassette Gateway vector set for high throughput and comparative analyses in ciona and vertebrate embryos. Roure A, Rothbacher U, Robin F, Kalmar E, Ferone G, Lamy C, Missero C, Mueller F, Lemaire P. PLoS One. 2007. 2(9):e916. 10.1371/journal.pone.0000916 PubMed 17878951