P2061
(Plasmid
#186299)
-
PurposeExpresses LexA-HBD-B112 under the control of pAct1 and Cas9 under the control of LexA-HBD-B112+Beta-estradiol inducible promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186299 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCerCC
- Backbone size w/o insert (bp) 3250
- Total vector size (bp) 11011
-
Vector typeBacterial Expression, Yeast Expression, CRISPR, Synthetic Biology
-
Selectable markersG418
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameLexA-HBD-B112
-
Alt nameLexA-human estrogen receptor hormone binding domain-B112
-
SpeciesH. sapiens (human), Synthetic; E.coli
-
Insert Size (bp)1974
- Promoter PACT1
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer TTTTGGCGCGCCtctgtcga
- 3′ sequencing primer aattgttatccgctcacaattcc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCas9
-
SpeciesS. pyogenes
-
Insert Size (bp)4149
- Promoter 2xLexop-minimalCyc1
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer aattaaccctcactaaagg
- 3′ sequencing primer aatacgactcactataggg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
P2061 was a gift from Joerg Stelling (Addgene plasmid # 186299 ; http://n2t.net/addgene:186299 ; RRID:Addgene_186299) -
For your References section:
Autorepression-Based Conditional Gene Expression System in Yeast for Variation-Suppressed Control of Protein Dosage. Azizoglu A, Loureiro C, Venetz J, Brent R. Curr Protoc. 2023 Jan;3(1):e647. doi: 10.1002/cpz1.647. 10.1002/cpz1.647 PubMed 36708363