Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

P2061
(Plasmid #186299)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186299 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCerCC
  • Backbone size w/o insert (bp) 3250
  • Total vector size (bp) 11011
  • Vector type
    Bacterial Expression, Yeast Expression, CRISPR, Synthetic Biology
  • Selectable markers
    G418

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    LexA-HBD-B112
  • Alt name
    LexA-human estrogen receptor hormone binding domain-B112
  • Species
    H. sapiens (human), Synthetic; E.coli
  • Insert Size (bp)
    1974
  • Promoter PACT1

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer TTTTGGCGCGCCtctgtcga
  • 3′ sequencing primer aattgttatccgctcacaattcc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Cas9
  • Species
    S. pyogenes
  • Insert Size (bp)
    4149
  • Promoter 2xLexop-minimalCyc1

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer aattaaccctcactaaagg
  • 3′ sequencing primer aatacgactcactataggg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    P2061 was a gift from Joerg Stelling (Addgene plasmid # 186299 ; http://n2t.net/addgene:186299 ; RRID:Addgene_186299)
  • For your References section:

    Autorepression-Based Conditional Gene Expression System in Yeast for Variation-Suppressed Control of Protein Dosage. Azizoglu A, Loureiro C, Venetz J, Brent R. Curr Protoc. 2023 Jan;3(1):e647. doi: 10.1002/cpz1.647. 10.1002/cpz1.647 PubMed 36708363