pMpGE010-sgRNA-Target1 (MpRTN1)
(Plasmid
#186295)
-
PurposeBinary vector for CRISPR/Cas9 (target 1: MpRTN1) in plants (for Agrobacterium-mediated genetic transformation)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186295 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMpGE010
- Backbone size w/o insert (bp) 17689
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA-Target1
-
Alt namesgRNA- MpRTN1
-
gRNA/shRNA sequenceTGTGGCGGAAGGAGCAGTGG
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMpGE010-sgRNA-Target1 (MpRTN1) was a gift from Yutaka Kodama (Addgene plasmid # 186295 ; http://n2t.net/addgene:186295 ; RRID:Addgene_186295) -
For your References section:
The ER membrane-bending protein RETICULON facilitates chloroplast relocation movement in Marchantia polymorpha. Ishikawa K, Konno R, Hirano S, Fujii Y, Fujiwara M, Fukao Y, Kodama Y. Plant J. 2022 Apr 27. doi: 10.1111/tpj.15787. 10.1111/tpj.15787 PubMed 35476214