PET28a-cpLumiLuc-amylase sensor
(Plasmid
#186293)
-
PurposeExpression alpha-amylase sensor in e coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186293 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePET28a
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 6542
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namecpLumiLuc-amylase sensor
-
Insert Size (bp)1302
-
Tag
/ Fusion Protein
- HisTag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GCGCCGGTGATGCCGGCCACGATGCGTCCGGCGTAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PET28a-cpLumiLuc-amylase sensor was a gift from Kirill Alexandrov (Addgene plasmid # 186293 ; http://n2t.net/addgene:186293 ; RRID:Addgene_186293) -
For your References section:
Engineering and exploiting synthetic allostery of NanoLuc luciferase. Guo Z, Parakra RD, Xiong Y, Johnston WA, Walden P, Edwardraja S, Moradi SV, Ungerer JPJ, Ai HW, Phillips JJ, Alexandrov K. Nat Commun. 2022 Feb 10;13(1):789. doi: 10.1038/s41467-022-28425-2. 10.1038/s41467-022-28425-2 PubMed 35145068