pMpGE_En03-sgRNA-Target1 (MpRTN1)
(Plasmid
#186291)
-
PurposeGateway entry vector for sgRNA (target 1: MpRTN1). Transient expression of sgRNA (Target 1: MpRTN1) for MpRTN1 in plant cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186291 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMpGE_En03
- Backbone size w/o insert (bp) 3214
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA-Target1
-
Alt namesgRNA- MpRTN1
-
gRNA/shRNA sequenceTGTGGCGGAAGGAGCAGTGG
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMpGE_En03-sgRNA-Target1 (MpRTN1) was a gift from Yutaka Kodama (Addgene plasmid # 186291 ; http://n2t.net/addgene:186291 ; RRID:Addgene_186291) -
For your References section:
The ER membrane-bending protein RETICULON facilitates chloroplast relocation movement in Marchantia polymorpha. Ishikawa K, Konno R, Hirano S, Fujii Y, Fujiwara M, Fukao Y, Kodama Y. Plant J. 2022 Apr 27. doi: 10.1111/tpj.15787. 10.1111/tpj.15787 PubMed 35476214