Skip to main content
Addgene

pEGFP.N3-myc-SLC35A2
(Plasmid #186285)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186285 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP.N3
  • Total vector size (bp) 5927
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SLC35A2
  • Species
    H. sapiens (human)
  • Entrez Gene
    SLC35A2 (a.k.a. CDG2M, CDGX, UDP-Gal-Tr, UGALT, UGAT, UGT, UGT1, UGT2, UGTL)
  • Promoter CMV
  • Tag / Fusion Protein
    • MYC (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site bamhI (not destroyed)
  • 5′ sequencing primer ATGTCGTAACAACTCCGCCC
  • 3′ sequencing primer GCTGAACTTGTGGCCGTTTA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP.N3-myc-SLC35A2 was a gift from Somshuvra Mukhopadhyay (Addgene plasmid # 186285 ; http://n2t.net/addgene:186285 ; RRID:Addgene_186285)
  • For your References section:

    Functional analyses of the UDP-galactose transporter SLC35A2 using the binding of bacterial Shiga toxins as a novel activity assay. Li D, Mukhopadhyay S. Glycobiology. 2019 Jun 1;29(6):490-503. doi: 10.1093/glycob/cwz016. 10.1093/glycob/cwz016 PubMed 30834435