Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCMV-3×FLAG-SLC35A1
(Plasmid #186282)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186282 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCMV
  • Total vector size (bp) 7262
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SLC35A1
  • Species
    H. sapiens (human)
  • Entrez Gene
    SLC35A1 (a.k.a. CDG2F, CMPST, CST, hCST)
  • Promoter CMV
  • Tag / Fusion Protein
    • 3×FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-3×FLAG-SLC35A1 was a gift from Somshuvra Mukhopadhyay (Addgene plasmid # 186282 ; http://n2t.net/addgene:186282 ; RRID:Addgene_186282)
  • For your References section:

    A three-pocket model for substrate coordination and selectivity by the nucleotide sugar transporters SLC35A1 and SLC35A2. Li D, Mukhopadhyay S. J Biol Chem. 2021 Sep;297(3):101069. doi: 10.1016/j.jbc.2021.101069. Epub 2021 Aug 10. 10.1016/j.jbc.2021.101069 PubMed 34384782