pcI-ts,ind+-(mtSSB delta20)
(Plasmid #186280)

• Purpose: Expresses Human Mitochondrial SSB in E. coli
• Depositing Lab: Kenneth Johnson
• Publication: Qian et al J Biol Chem. 2017 Aug 4;292(31):13068-13084. doi: 10.1074/jbc.M117.791392. Epub 2017 Jun 14.

Backbone

• Vector backbone: pcI-ts,ind+
• Backbone size w/o insert (bp): 3400
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Mitochondrial Single Stranded DNA Binding Protein
• Alt name: mtSSB
• Species: H. sapiens (human)
• Mutation: First 20 amino acids corresponding to probable mitochondrial targeting sequence deleted
• GenBank ID: M94556.1
• Entrez Gene: SSBP1 (a.k.a. Mt-SSB, OPA13, SOSS-B1, SSBP, mtSSB)
• Promoter: lambda

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: AAATTGCTTTAAGGCGACGTGC
• 3′ sequencing primer: GCTTCGCAACGTTCAAATCCGCTCC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Received from Yufeng Qian

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA