Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAP14
(Plasmid #186262)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186262 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSEVA531
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    wgaAB bicistronic
  • Alt name
    RmExpA1; RmExpA23
  • Species
    Synthetic
  • Insert Size (bp)
    4120
  • GenBank ID
    CAC49295.1 CAC49296.1
  • Promoter PEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTATAGTCGAATAAA)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGAAAGGCCCAGTCTTTC
  • 3′ sequencing primer CGCCAGGGTTTTCCCAGTCACGAC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    EL222
  • Alt name
    ELI_04755
  • Alt name
    Light-activated DNA-binding protein EL222 from Erythrobacter litoralis
  • Species
    Erythrobacter litoralis
  • GenBank ID
    ELI_04755 ELI_04755
  • Entrez Gene
    ELI_04755 (a.k.a. ELI_04755)
  • Promoter LacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAA)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATTTGACAGCTTATCATCGATAAA
  • 3′ sequencing primer TGCCGAGGATGACGATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAP14 was a gift from Yongku Cho (Addgene plasmid # 186262 ; http://n2t.net/addgene:186262 ; RRID:Addgene_186262)
  • For your References section:

    Optogenetics in Sinorhizobium meliloti Enables Spatial Control of Exopolysaccharide Production and Biofilm Structure. Pirhanov A, Bridges CM, Goodwin RA, Guo YS, Furrer J, Shor LM, Gage DJ, Cho YK. ACS Synth Biol. 2021 Feb 19;10(2):345-356. doi: 10.1021/acssynbio.0c00498. Epub 2021 Jan 19. 10.1021/acssynbio.0c00498 PubMed 33465305