Skip to main content
Addgene

LentiCRISPR-V2_hMSH2
(Plasmid #186155)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186155 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    LentiCRISPR V2
  • Backbone size w/o insert (bp) 12992
  • Total vector size (bp) 13012
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MSH2
  • gRNA/shRNA sequence
    TGAGAGGCTGCTTAATCCAC
  • Species
    H. sapiens (human)
  • Entrez Gene
    MSH2 (a.k.a. COCA1, FCC1, HNPCC, HNPCC1, LCFS2, LYNCH1, MMRCS2, MSH-2, hMSH2)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer gagggcctatttcccatgattcc
  • 3′ sequencing primer N/A
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiCRISPR-V2_hMSH2 was a gift from David McFadden (Addgene plasmid # 186155 ; http://n2t.net/addgene:186155 ; RRID:Addgene_186155)

  • For your References section:

    Engineering Forward Genetics into Cultured Cancer Cells for Chemical Target Identification. Povedano JM, Liou J, Wei D, Srivatsav A, Kim J, Xie Y, Nijhawan D, McFadden DG. Cell Chem Biol. 2019 Sep 19;26(9):1315-1321.e3. doi: 10.1016/j.chembiol.2019.06.006. Epub 2019 Jul 11. 10.1016/j.chembiol.2019.06.006 PubMed 31303577
Related items:
Commonly requested with: