-
PurposeExpresses codon-optimized full length SARS-CoV-2 BA.4/5 Spike
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186031 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepCAGGS
- Backbone size w/o insert (bp) 4716
- Total vector size (bp) 8523
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSARS-CoV-2 BA.4/5 Spike
-
Alt nameSARS-CoV-2 Omicron Spike
-
Insert Size (bp)3806
-
MutationBA.2 mutations (T19I, LPPA24S, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K) with a Q493 reversion and Δ69-70, L452R and F486V
-
Entrez GeneS (a.k.a. GU280_gp02, spike glycoprotein)
- Promoter chicken β-actin promoter, CMV enhancer
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CTCTAGAGCCTCTGCTAACCATGTTC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.08.03.22278386 for medRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS SARS-CoV-2 BA.4/5 Spike was a gift from Marceline Côté (Addgene plasmid # 186031 ; http://n2t.net/addgene:186031 ; RRID:Addgene_186031) -
For your References section:
Spike recognition and neutralization of SARS-CoV-2 Omicron subvariants elicited after the third dose of mRNA vaccine. Tauzin A, Nicolas A, Ding S, Benlarbi M, Medjahed H, Chatterjee D, Dionne K, Gong SY, Gendron-Lepage G, Bo Y, Perreault J, Goyette G, Gokool L, Arlotto P, Morrisseau C, Tremblay C, Martel-Laferriere V, De Serres G, Levade I, Kaufmann DE, Cote M, Bazin R, Finzi A. Cell Rep. 2023 Jan 31;42(1):111998. doi: 10.1016/j.celrep.2023.111998. Epub 2023 Jan 9. 10.1016/j.celrep.2023.111998 PubMed 36656710