Skip to main content
Addgene

lentiCRISPR v2-sgFSP1
(Plasmid #186026)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186026 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Backbone manufacturer
    Feng Zhang
  • Backbone size w/o insert (bp) 12000
  • Total vector size (bp) 12000
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ferroptosis Suppressor Protein 1
  • Alt name
    FSP1
  • gRNA/shRNA sequence
    AGGTCTCGGTGGAATCGGGA
  • Species
    H. sapiens (human)
  • Entrez Gene
    AIFM2 (a.k.a. AMID, FSP1, PRG3)
  • Promoter U6

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCRISPR v2-sgFSP1 was a gift from Boyi Gan (Addgene plasmid # 186026 ; http://n2t.net/addgene:186026 ; RRID:Addgene_186026)

  • For your References section:

    DHODH-mediated ferroptosis defence is a targetable vulnerability in cancer. Mao C, Liu X, Zhang Y, Lei G, Yan Y, Lee H, Koppula P, Wu S, Zhuang L, Fang B, Poyurovsky MV, Olszewski K, Gan B. Nature. 2021 May;593(7860):586-590. doi: 10.1038/s41586-021-03539-7. Epub 2021 May 12. 10.1038/s41586-021-03539-7 PubMed 33981038
Related items:
Commonly requested with: