pET21b GFP-Rab10 Q68LHis
(Plasmid
#186015)
-
PurposeGFP-Rab10 Q68LHis
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186015 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneGFP-Rab10 Q68LHis
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP-Rab10 Q68LHis
-
SpeciesH. sapiens (human)
-
Entrez GeneRAB10
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET21b GFP-Rab10 Q68LHis was a gift from Suzanne Pfeffer (Addgene plasmid # 186015 ; http://n2t.net/addgene:186015 ; RRID:Addgene_186015) -
For your References section:
A feed-forward pathway drives LRRK2 kinase membrane recruitment and activation. Vides EG, Adhikari A, Chiang CY, Lis P, Purlyte E, Limouse C, Shumate JL, Spinola-Lasso E, Dhekne HS, Alessi DR, Pfeffer SR. Elife. 2022 Sep 23;11:e79771. doi: 10.7554/eLife.79771. 10.7554/eLife.79771 PubMed 36149401