Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKIF1C_P176L-GFP
(Plasmid #185980)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185980 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-N1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KIF1C
  • Alt name
    SAX2
  • Alt name
    KIAA0706
  • Alt name
    LTXS1
  • Species
    H. sapiens (human)
  • Mutation
    P176L - mutation causing HSP (SPG58)
  • Entrez Gene
    KIF1C (a.k.a. LTXS1, SATX2, SAX2, SPAX2, SPG58)
  • Promoter CMV
  • Tag / Fusion Protein
    • eGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer ggaggtctatataagcagag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKIF1C_P176L-GFP was a gift from Anne Straube (Addgene plasmid # 185980 ; http://n2t.net/addgene:185980 ; RRID:Addgene_185980)
  • For your References section:

    Force generation of KIF1C is impaired by pathogenic mutations. Siddiqui N, Roth D, Toleikis A, Zwetsloot AJ, Cross RA, Straube A. Curr Biol. 2022 Sep 12;32(17):3862-3870.e6. doi: 10.1016/j.cub.2022.07.029. Epub 2022 Aug 11. 10.1016/j.cub.2022.07.029 PubMed 35961316